miRNA Detection Technique



miRNA는 22개 정도의 ribonucleotide로 구성된 non-coding RNA로 taget mRNA (mesenger RNA)의 3`-UTR 내의 target site에 결합하여 단백질 합성을 억제하거나 mRNA의 분해를 유발하여 gene silencing을 유도합니다.


한 개의 miRNA는 여러 개의 다른 mRNA를 조절할 수 있고, 한 개의 mRNA가 여러 miRNA에 대한 multiple binding site를 갖고 있어서 복잡한 유전자 조절 관계를 형성합니다. miRNA는 생체 내에서 암, 심장 및 신경관련 질환, 인슐린 분비 등에 관련된 유전자 발현을 조절하며, 특히 암 등과 같은  종양의 진행에서 중요한 조절인자로 기능하기 떄문에 암의 조기진단, 맞춤형 약물진단, 예후진단 등의 Biomarker로 사용되고 있습니다.


<miRNA 검출을 위한 여러가지 방법>

                                       - Northern blot
                                       - Microarray를 이용한 Hybridization에 기반한 검출
                                       - Next Generation Sequencing
                                       - Stem loop 구조의 primer를 이용한 RT-PCR 및 정량적 PCR
                                       - Poly A polymerase를 이용한 poly A tailing으로 cDNA 합성 후 특이적 primer를  사용한 증폭

Higher Sensitivity

RNACt valueMelting
1 ug13.1780.50
100 ng16.6280.50
10 ng20.2280.50
1 ug24.2080.50
100 pg28.1480.50
10 pg31.4080.50
1 pg36.6380.50
NTCNoneNone

Amplification of hsa-miR-106b-5p by HB miR Multi Assay (System I, SYBR Green).

Higher Specificity

Synthetic target miRNA

Table. Sequences of let-7 family members


hsa-let-7 familySequence
hsa-let-7a-5pUGAGGUAGUAGGUUGUAUAGUU
hsa-let-7b-5pUGAGGUAGUAGGUUGUGUGGUU
hda-let-7c-5pUGAGGUAGUAGGUUGUAUGGUU
hsa-let-7d-5pAGAGGUAGUAGGUUGCAUAGUU
hsa-let-7e-5pUGAGGUAGGAGGUUGUAUAGUU

hsa-let-7e-5p

Higher Reactivity

Efficiency of cDNA synthesis of hsa-miR-21-5p is not affected by decrease in RT reaction time in HB miR Multi Assay (System I), whereas it is not the case in supplier Q, in which Ct value is significantly increased by a decrease in RT reaction time.


SystemⅠ

poly A tailing  기술 사용, 하나의 Total RNA 샘플로부터

 cDNA library를 제작, SYBR Green 또는 TaqMan-Probe를 

이용하여 여러 miRNA를 검출/분석하는 시스템



SystemⅡ

특이적으로 Target miRNA 만을 cDNA로 제작, SYBR Green 또는

TaqMan-Probe를 이용하여 Target miRNA를 검출/분석하는 시스템



임상진단의 경쟁력



경쟁사 제품
(Qiagen/ABI)
(주)하임바이오텍
RT / Real-Time PCR
RT / Real-Time PCR
분석프로세스Real-Time PCR


동시다중분석가능-가능
Real-Time PCR

SYBR Green (Qiagen)

TaqMan-Probe (ABI)


SYBR Green 

TaqMan-Probe 


SYBR Green 

TaqMan-Probe 


젤전기영동 분석Single : 정확
Multiplex : 가능
정확
정확

염기서열 분석

(DNA Sequencing)


정확
정확
정확